SGN Marker solcap_snp_sl_100453

SGN-M18008

Synonyms  
CL016728-0187
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54339)
Chromosome
11
Position
6.62 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAAACGTTTTAGTGGTCTCTTCTATAATCCCTCTTCCTTAATATCGTGCATGATAACATTATT
  
3' flanking region
CTACCTTCTGTTGTGAGTGTTGTATGAGGACTGCAGACTATNACTTGCACCTATTGTTGTGCTTTTACATGCGCTAGAACTCATGATATTGTTNTTGAAT
SNP nucleotide
TG
SNPdb format
GGAAACGTTTTAGTGGTCTCTTCTATAATCCCTCTTCCTTAATATCGTGCATGATAACATTATT[T/G]
CTACCTTCTGTTGTGAGTGTTGTATGAGGACTGCAGACTATNACTTGCACCTATTGTTGTGCTTTTACATGCGCTAGAACTCATGATATTGTTNTTGAAT
  
Genomic location of solcap_snp_sl_100453  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18008 marker 18008
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)