SGN Marker T1162

SGN-M1807
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.07.1
Tomato EST read: TFBBJ35TH
Arabidopsis best BAC match: AL021635.1
Arabidopsis position: 4.1170000
Arabidopsis identities: 0.609
Best GenBank protein hit: CAB78254.1
Evalue: 9.8e-71
Identities: 0.603
Description: putative C-4 sterol methyl oxidase [Arabidopsis
Comment: "first of three enzymic steps required to remove the two C-4 methyl groups leading to cholesterol (animal), ergosterol (fungal), and stigmasterol (plant)"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49397)
Chromosome
1
Position
76.72 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47332)
Chromosome
1
Position
62.75 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39526)
Chromosome
1
Position
59.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1162 was used as an overgo probe on plate 8 [well E10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGGCTTCTATGTCTCTAGGGAGA
B sequence
CTCCGTATGTCAAATTTCTCCCTA
AB sequence
GAGGCTTCTATGTCTCTAGGGAGAAATTTG
Marker sequence
CAATCACATTTTCATAAAAAAAAAAAAGAAGAAAAAATGTTGCCTTTTGA
GAGTATTGAAGAGGCTTCTATGTCTCTAGGGAGAAATTTGACATACGGAG
AGACATTATGGTTCAATTACACTGCAAATAAATCAGATTTCTATCTCTAT
TGCCATAACACAATCTTTTTGATCATTTTCTACACTTTGGTCCCTTTACC
AATGGTTATGATTGAGCTATTAAGGTCCAAAAAGTTTGAAATTTACAAGA
TTCAACCCAAAACTACATTTACTTTATCTGAAATGATGGAATGTTACAGA
AAAGTCCTCATCACTTTTGTATTTGCTGCTGGTCCTCTACAACTTTTTTC
TTATCCCATCATTGAGTGGGTTGGAATAAGGACAAGTTTACCCCTGCCAT
CAGCTTCAGAAGTATTTTGGCAATTAGTTGTGTATTTTTTAGTTGAAGAT
TATGCAAATTATTGGCTTCACAGAATGCTCCATCACTACAAATGGGGTTA
TGACAAAATCCACAGAGTTCATCATGAATATGTGGCCCCAATTAGTTTTG
CAGCACCTTATGCCCACTGGGCTGAAATTATTATATTGGGCTTAGCTTCT
TTTCTTGGCCCACT
Genomic location of T1162  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1807 marker 1807
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)