SGN Marker solcap_snp_sl_100522

SGN-M18070

Synonyms  
CL017204-0355
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54401)
Chromosome
10
Position
7.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATGTCACTTCACTTANATCNGCAAAACCACTTTCAAGATTCTTGAAATGGACCCAACATCTNAAAACTATTTGCTCTAAAGCTTTGGGTTCAGGCTCGG
  
3' flanking region
GCGTGGTTACGTACAAATTGGACATGTAGAGAAGGCAAGTGTGGTGCCAAAAGGTCATATGGCAATTTATGTGGGACAAAGAGATGGAGATTGTAAGAGG
SNP nucleotide
AG
SNPdb format
CATGTCACTTCACTTANATCNGCAAAACCACTTTCAAGATTCTTGAAATGGACCCAACATCTNAAAACTATTTGCTCTAAAGCTTTGGGTTCAGGCTCGG[A/G]
GCGTGGTTACGTACAAATTGGACATGTAGAGAAGGCAAGTGTGGTGCCAAAAGGTCATATGGCAATTTATGTGGGACAAAGAGATGGAGATTGTAAGAGG
  
Genomic location of solcap_snp_sl_100522  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18070 marker 18070
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)