Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100557

SGN-M18104

Synonyms  
CL017400-0465
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54435)
Chromosome
5
Position
11.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGTCTCTTTTGGCTCATTTGTTTGTATTCTGTATTGCAGCGTGTAAAATATTGTGAAACAATTTAAACAATTGTACTGGCACAGAACAACGGTGAGGAG
  
3' flanking region
ATGGTCGTACTCTTTACTAGATGCAGTTTCCTGCAATGTTTAAAGANTGTATGGAGGATGAATACATTGCATGCTGGTGTTTGTTGCTGGAGGACACAGC
SNP nucleotide
TC
SNPdb format
TCGTCTCTTTTGGCTCATTTGTTTGTATTCTGTATTGCAGCGTGTAAAATATTGTGAAACAATTTAAACAATTGTACTGGCACAGAACAACGGTGAGGAG[T/C]
ATGGTCGTACTCTTTACTAGATGCAGTTTCCTGCAATGTTTAAAGANTGTATGGAGGATGAATACATTGCATGCTGGTGTTTGTTGCTGGAGGACACAGC
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_100557  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18104 marker 18104
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)