Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100561

SGN-M18108

Synonyms  
CL017416-0406
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54439)
Chromosome
3
Position
57.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGATGGGAGATGGTGGGGGCATTGGAGATCCTTACAATTTTTCCCAAAACAAGAAGTCGTTGCTTGGAAAGATTATGAGACTTGATGTCGATAGCACACC
  
3' flanking region
AGTAAGTTGTCTTCAAGTTTCTTGAAAAAGTNCNCTTATATCAATCTACAGTATTTCTTATATCCATTTGTCTATGCTAACTTTGATGGTCTTGCCACTA
SNP nucleotide
TG
SNPdb format
TGATGGGAGATGGTGGGGGCATTGGAGATCCTTACAATTTTTCCCAAAACAAGAAGTCGTTGCTTGGAAAGATTATGAGACTTGATGTCGATAGCACACC[T/G]
AGTAAGTTGTCTTCAAGTTTCTTGAAAAAGTNCNCTTATATCAATCTACAGTATTTCTTATATCCATTTGTCTATGCTAACTTTGATGGTCTTGCCACTA
  
Genomic location of solcap_snp_sl_100561  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18108 marker 18108
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)