SGN Marker T1171

SGN-M1811
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.1
Tomato EST read: TFBBK32TH
Arabidopsis best BAC match: AL132955.1
Arabidopsis position: 3.1105000
Arabidopsis identities: 0.634
Best GenBank protein hit: CAA35239.1
Evalue: 6.7e-91
Identities: 0.917
Description: precursor protein (AA -27 to 320) of mature malate dehydrogenase [Citrullus lanatus]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39530)
Chromosome
7
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1171 was used as an overgo probe on plate 7 [well G11]

Plausible BAC Matches:   P252J02,   P335F15

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGAGGTCAATCTCCCAGTAGTTGG
B sequence
TATGCCAGCATGACCACCAACTAC
AB sequence
TGAGGTCAATCTCCCAGTAGTTGGTGGTCA
Marker sequence
CGAGGCCATTGCTAAGTACTGCCCCAATGCTCTGGTCAATATGATAAGCA
ACCCAGTGAATTCCACTGTCCCTATTGCTGCTGAGGTGTTTAAGAAAGCT
GGAACTTATGATGAAAAGAAGCTCTTTGGAGTTACCATGCTTGATGTGGT
TAGGGCCAAGACATTTTATGCTGGAAAAGCTAAAGTAAATGTTGCTGAGG
TCAATCTCCCAGTAGTTGGTGGTCATGCTGGCATAACTATCCTCCCATTA
TTTTCTCAAGCCACTCCAAAGGCAAATCTATCAGATGAGGAAATTGTTGC
ACTCACAAAGCGAACCCAAGATGGTGGGACAGAAGTTGTAGAGGCCAAGG
CTGGAAAGGGTTCAGCCACCCTCTCAATGGCCTATGCTGGGGCTATTTTT
GCCGATGCTTGCTTGAAGGGGTTGAATGGAGTTCCCGATGTTGTTGAATG
TGCTTTTGTGCAGTCCAATGTCACCGAGCTTCCCTTCTTCGCATCCAAAG
TAAGACTTGGGAAAAATGGAGTGGAGGAAGTCCTAGGGTTGGGTCCACTT
Genomic location of T1171  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1811 marker 1811
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)