SGN Marker T1173

SGN-M1813
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TFBBK51TH
Arabidopsis best BAC match: AC007396.6
Arabidopsis position: 1.1415000
Arabidopsis identities: 0.646
Best GenBank protein hit: BAA19252.1
Evalue: 1.7e-92
Identities: 0.871
Description: 21D7 (subunit of the 26S proteasome complex ) [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39531)
Chromosome
1
Position
87.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1173 was used as an overgo probe on plate 9 [well H4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCACCTCCTTCCAAATCCCTTTC
B sequence
AGAAGGGTCAGCAGATGAAAGGGA
AB sequence
AGCACCTCCTTCCAAATCCCTTTCATCTGC
Marker sequence
CTCCAAGAAACAAGAAAGATGACTCAAGATGTGGAGATGGCCGACCAAGC
ACCTCCTTCCAAATCCCTTTCATCTGCTGACCCTTCTGTCTTGCCCCATT
TGAAGGACATAGCATCGTTGATTGAGACTGGGGCATATGCTCGTGAGGTC
AGGAGGATTTCCAGAGCTGTGAGGCTGACTATGGTACTGAGGAAGAAGCT
AAAGGCTTCTTCACTAGGTGCTTTCCTCAATTTTGTTCTAGTGCCTGGAT
CAGACGTGCATTCCCGGCTATCTTCCTTCCTACCCAAGGAAGATGAACAT
GATATGGAAGTTGATAGTGCAACATCCGGAACTCTGGCATCAGTCAAGCA
TTCTTTGCCAGAGCTTGAGATCTATTGCTACTTGCTTGTCTTGATATTCT
TAATTGATCAGAAGAAATACGATGAGGCCAAGGCATGCTCCTCAGCAAGT
ATTGCTCGTCTAAAAACCGTGAACAGGAGGACAGTTGATGTATTAGCATC
TAGGCTTTATTTCTACTACTCTCTGTGTTATGAACTTACTGGTGATCTTG
CCGAAATTCGAGGTAATCTCCTCTCATTGCACCGTATTGCAACATTACGC
CGTGATGAGTTGGGTCAAGAAACTCTTCTTAATCTGCTATTGCGGAATTA
TCTTC
Genomic location of T1173  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1813 marker 1813
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)