SGN Marker solcap_snp_sl_100594

SGN-M18139

Synonyms  
CL017545-0168
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54470)
Chromosome
12
Position
2.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCAATTCATAATTAGACAGAAATGGAAAGGAAA
  
3' flanking region
AAGACAAGATGGATTGCTTGCATTGTATGGGGAAATTGAGAAAGCAGTAGAGATATATTCTTCACTTGAAGGTAGTAGAACCATTACTATTATGATTGAT
SNP nucleotide
CG
SNPdb format
CTCAATTCATAATTAGACAGAAATGGAAAGGAAA[C/G]
AAGACAAGATGGATTGCTTGCATTGTATGGGGAAATTGAGAAAGCAGTAGAGATATATTCTTCACTTGAAGGTAGTAGAACCATTACTATTATGATTGAT
  
Genomic location of solcap_snp_sl_100594  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18139 marker 18139
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)