SGN Marker T1176

SGN-M1815
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.01
Tomato EST read: TFBBL51TH
Arabidopsis best BAC match: AC009323.4
Arabidopsis position: 1.1040000
Arabidopsis identities: 0.551
Best GenBank protein hit: AAG09094.1
Evalue: 2.4e-73
Identities: 0.685
Description: Unknown protein [Arabidopsis thaliana]
Comment: 2.00e-39 match with gb|AAB82766.1| (U89510) b-keto acyl reductase [Hordeum vulgare]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39533)
Chromosome
1
Position
116.90 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1176 was used as an overgo probe on plate 9 [well C6]

Plausible BAC Matches:   P001H15

 Non-Plausible BAC matches

P255L03,   P118A08,   P131O24

 Overgo Sequences

A sequence
GCTACTTTCCGTTGTCCAGATGAG
B sequence
GAGGTTTCCATCCCATCTCATCTG
AB sequence
GCTACTTTCCGTTGTCCAGATGAGATGGGA
Marker sequence
GTACATGGGGTCTGAAGGGCCTTCACCTGTGATCGTACATGTAACTGGTT
TCAAGAAATTTCATGGAGTTGCTGAAAATCCAACAGAAACCATTGTAAGT
AATCTTAAAGATTATATGAAGAAAAGGGGTATGCCCAAAGGGCTGATCCT
TGGGAATTGCAGCATCCTTGATACTGCAGGCCAGGGAGCCCTAGTTCCCT
TATATCATACACTGCAAGCTGGTTTAAGCGGTGGTGACTCGGAGTCATCT
AATTCCAAGAGAGTTATTTGGGTACACTTTGGAGTTAATAGTGGTGCCAC
AATGTTTGCCATACAGAATCAGGCTGTCAATGAAGCTACTTTCCGTTGTC
CAGATGAGATGGGATGGAAACCTCAAAAAGTACCTATTGTTCCTGCAGAT
GGGGCAATTTCGCGTAAACGAGAGACTTCTCTTCCGGTGGAGGAAATGAC
CAAGGTATTGGCCAAGATGGGATATGAAGTAATGACCTCTGATGATGCAG
GCCGGTTTGTATGCAATTATGTATACTACCATTCCTTGCGTTTTGCAGAG
CATAATGGTGTCCGATCACTATTTGTA
Genomic location of T1176  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1815 marker 1815
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)