SGN Marker solcap_snp_sl_100623

SGN-M18166

Synonyms  
CL017721-0135
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54497)
Chromosome
4
Position
9.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAGATTAAGAAGGAGAAACTCGAAGCGATTTTAAGCAGAGTTGGAGGTAAATCTCCACCGAGTGAAGAGGAACTTGTGTTGTTGCTTGATGAATTGGAT
  
3' flanking region
AGAACGGAGATGGATGTATTAGTTTAGAGAATTTTGAAACTATTACCTCGGCGTTTGAGTCGACANCGACGTCGGCNGCGGGAGATGCAGGTGAGATGAG
SNP nucleotide
AG
SNPdb format
TAAGATTAAGAAGGAGAAACTCGAAGCGATTTTAAGCAGAGTTGGAGGTAAATCTCCACCGAGTGAAGAGGAACTTGTGTTGTTGCTTGATGAATTGGAT[A/G]
AGAACGGAGATGGATGTATTAGTTTAGAGAATTTTGAAACTATTACCTCGGCGTTTGAGTCGACANCGACGTCGGCNGCGGGAGATGCAGGTGAGATGAG
  
Genomic location of solcap_snp_sl_100623  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18166 marker 18166
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)