SGN Marker solcap_snp_sl_100631

SGN-M18174

Synonyms  
CL017750-0442
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54505)
Chromosome
12
Position
2.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGATATCGCGAATAATTCATTTTCAGGCTTAATCCCTGAATTCTTCTTGCTTGGTGCACTTAAATCTATATATATAGATGGAAACCAATTCTCAGGTGA
  
3' flanking region
ATTCCTAAAGATTTCTTTGCCAAAATGGGGTCTCTTAAGAAGATATGGC
SNP nucleotide
AG
SNPdb format
TTGATATCGCGAATAATTCATTTTCAGGCTTAATCCCTGAATTCTTCTTGCTTGGTGCACTTAAATCTATATATATAGATGGAAACCAATTCTCAGGTGA[A/G]
ATTCCTAAAGATTTCTTTGCCAAAATGGGGTCTCTTAAGAAGATATGGC
  
Genomic location of solcap_snp_sl_100631  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18174 marker 18174
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)