SGN Marker solcap_snp_sl_100657

SGN-M18198

Synonyms  
hp2_exon2_11_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54529)
Chromosome
1
Position
46.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTATGAGAAC
  
3' flanking region
TTGTACCAAGTTATACCATATACGATGTTGAATGTCCCGACCATTCATTTCGCAAGTTCACGGATGACGGTCTATATTTTGTAAGTTTC
SNP nucleotide
AG
SNPdb format
TTATGAGAAC[A/G]
TTGTACCAAGTTATACCATATACGATGTTGAATGTCCCGACCATTCATTTCGCAAGTTCACGGATGACGGTCTATATTTTGTAAGTTTC
  
Genomic location of solcap_snp_sl_100657  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18198 marker 18198
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)