Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1185

SGN-M1822
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA24TH
Arabidopsis best BAC match: AC009322.1
Arabidopsis position: 1.1550000
Arabidopsis identities: 0.758
Best GenBank protein hit: AAD55468.1
Evalue: 2.1e-86
Identities: 0.758
Description: Hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42382)
Chromosome
5
Position
62.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39537)
Chromosome
12
Position
57.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 11310)
Chromosome
5
Position
62.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T1185 was used as an overgo probe on plate 14 [well C1]

Plausible BAC Matches:   P172I12,   P009J11,   P285J23,   P120H16,   P050N24,   P185A15,   P282O12,   P231A14,   P304B15,   P288J14,   P198C21

 Overgo Sequences

A sequence
TGCTCTAGTCGATGCTCCACAAAC
B sequence
ATTCATCGAGAAGCCGGTTTGTGG
AB sequence
TGCTCTAGTCGATGCTCCACAAACCGGCTT
Marker sequence
GGTTATAATGTCGGATTCCGGTGCACCTTCTGCTCTAGTCGATGCTCCAC
AAACCGGCTTCTCGATGAATAACAATCGTGCACGAACCGATCCTCGTGAG
CAAGAAGCCGTTTACGACATTATGAGGGCTACGGGGAACGATTGGGCCAC
CGATATCCCTGATGTTTGTCGTGGTCGATGGCATGGTATTGAGTGCATGC
CGGATAATGACAATGTGTACCATGTTGTCTCACTTTCCTTCGGTGCATTG
TCCGATGACACAGCGTTTCCTACGTGTGACTCGACTCATTCCTTCATTTC
ACCTTCAGTTAGGAAACTTCCACACCTTCGAATTTTGTTCTTCTATCGTT
GCTTTAGTAACAATCCTCAGCCCATTCCAGGATTTTTAGCCCAATTAGGG
CCCACTTTGCAAACACTAGTTTTAAGGGAAAATGGGTTCACAGGGCCCAT
TCCTAATGAATTGGGTAACCTAACCCGTTTGAGAGTTCTAGATCTTCACA
AGAACAATCTTAATGGTTCAATACCCATCTCTCTGGGTCGGATCACCGGT
TTGAGGTCATTAGATTTGAGCGACAACAAACTAACCGGTTCTATTCCGAG
TTTAACTTT
Genomic location of T1185  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1822 marker 1822
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)