SGN Marker solcap_snp_sl_100694

SGN-M18235

Synonyms  
Le013946_77
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54566)
Chromosome
6
Position
0.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGGCTCAATGCAC
  
3' flanking region
TATTTATCATGAAATCAAAAAGTCTCCTCGCTTCATCAAGTTGACCAGTC
SNP nucleotide
TC
SNPdb format
TAGGCTCAATGCAC[T/C]
TATTTATCATGAAATCAAAAAGTCTCCTCGCTTCATCAAGTTGACCAGTC
  
Genomic location of solcap_snp_sl_100694  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18235 marker 18235
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)