SGN Marker solcap_snp_sl_100698

SGN-M18239

Synonyms  
Le018232_64
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54570)
Chromosome
11
Position
47.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGGCTTCCTTACTTCTTCTTTTCGTTGTTTGATTCCATTGTTTTATATTA
  
3' flanking region
CACTTGATGCTGTAATT
SNP nucleotide
TC
SNPdb format
GGGCTTCCTTACTTCTTCTTTTCGTTGTTTGATTCCATTGTTTTATATTA[T/C]
CACTTGATGCTGTAATT
  
Genomic location of solcap_snp_sl_100698  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18239 marker 18239
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)