SGN Marker T1188

SGN-M1824
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TPTAA29TV
Arabidopsis best BAC match: AC005496.2
Arabidopsis position: 2.1680000
Arabidopsis identities: 0.876
Best GenBank protein hit: AAC35232.1
Evalue: 9.6e-72
Identities: 0.876
Description: "putative thiamin biosynthesis protein [Arabidopsis thaliana]/ e-43, thiamin biosynthesis protein [Bacillus halodurans]"
Comment: similar to procaryotic thiC
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49402)
Chromosome
6
Position
1.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47336)
Chromosome
6
Position
1.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39538)
Chromosome
6
Position
3.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1188 was used as an overgo probe on plate 2 [well A9]

Plausible BAC Matches:   P323J21,   P193M08,   P231D08,   P036B19,   P298C11,   P246L12,   P107A05

 Overgo Sequences

A sequence
ATAGCATCCATGCCCTGCTGAATG
B sequence
GAAATGCAGAGGAAGCCATTCAGC
AB sequence
ATAGCATCCATGCCCTGCTGAATGGCTTCC
Marker sequence
CGCGTTTTCTCATTACTAACAAAGGAGAGTTTCATTGATACAAGCTGTTT
GTCTCAGTTTATTTAACAGTACCAAACTAGATACTTACCTAATACTTGAT
AATGAGGCTCCTACTACCGCCTCCTTGACTGGCCGATGGAGTTGTGATCA
CTTCAAAAATCTGTGAGCCAGTTTCGATCTTTACACATTCGTTTGGCTCT
TCAAAGAGTTGATGTAATTTTCTGGCAAGTAGATCTCACCGCCAACCTCA
CCGTGTTGTTCCCCACTAATGGTTTTTTTTGCAGCTTGAAACGCTGCACT
CATAGCATCCATGCCCTGCTGAATGGCTTCCTCTGCATTTCCATAACCAT
GATTTTCAGCATACTTCCTTATATCTTCGGTTATTTTCATGGAGCAAAAC
TTAGGACCGCACATCGAGCAGAAATGTGCCACTTTAGCCCCATCGGCTGG
TAAAGTTTCGTCGTGAAAGGACATTGCAGTAACGGGGTCCAATGACAAAG
CGAATTGGTCCATCCATCTGAACTCAAATCTTGCCTTGCTAAGTGCGTCA
TCCCAAGCTTGAGATAGCGGGTGACCTTTTGCAAGATCAGCTGCATGAGC
AGCTATCTTATATGATATTACACCTGTCTTCACGTCATCGCG
Genomic location of T1188  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1824 marker 1824
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)