SGN Marker solcap_snp_sl_100712

SGN-M18253

Synonyms  
PSY1_Promoter_SNP1
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70342)
Chromosome
3
Position
34.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54584)
Chromosome
3
Position
8.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAAATAAAATTAAACGATTTAATCAACTTAATTTAATTTTTCAATGTGG
  
3' flanking region
TCAATTTTTATCCAAATACTTTTACACCCACTTTTCACCATCACAAGGGG
SNP nucleotide
AG
SNPdb format
CCAAATAAAATTAAACGATTTAATCAACTTAATTTAATTTTTCAATGTGG[A/G]
TCAATTTTTATCCAAATACTTTTACACCCACTTTTCACCATCACAAGGGG
  
Genomic location of solcap_snp_sl_100712  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18253 marker 18253
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)