SGN Marker solcap_snp_sl_100715

SGN-M18256

Synonyms  
PTOX_40_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54587)
Chromosome
11
Position
4.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTATTTGGTGAGTGTTACATATCTTCCTTAATACTCTCG
  
3' flanking region
GACTCGATATCTATCTGGTTCAGTAATCTAAACCGTTTTGTGATTGCATCAGATGAGTTT
SNP nucleotide
TG
SNPdb format
TTATTTGGTGAGTGTTACATATCTTCCTTAATACTCTCG[T/G]
GACTCGATATCTATCTGGTTCAGTAATCTAAACCGTTTTGTGATTGCATCAGATGAGTTT
  
Genomic location of solcap_snp_sl_100715  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18256 marker 18256
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)