SGN Marker solcap_snp_sl_100721

SGN-M18262

Synonyms  
SGN-U149575_TG14_snp657
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70344)
Chromosome
2
Position
33.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66881)
Chromosome
2
Position
48.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63366)
Chromosome
2
Position
67.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54593)
Chromosome
2
Position
36.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAAGAAATTATTGTCTCTCTCTTTTTGTTTATAATTCTTTTTTGAGTTT
  
3' flanking region
TAATCATTACTCGAATCTGGCTCATAACCAGTAAGCTATAAAGGTCCAGT
SNP nucleotide
TC
SNPdb format
CCAAGAAATTATTGTCTCTCTCTTTTTGTTTATAATTCTTTTTTGAGTTT[T/C]
TAATCATTACTCGAATCTGGCTCATAACCAGTAAGCTATAAAGGTCCAGT
  
Genomic location of solcap_snp_sl_100721  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18262 marker 18262
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)