SGN Marker solcap_snp_sl_100728

SGN-M18269

Synonyms  
SGN-U313641_snp560
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54600)
Chromosome
1
Position
86.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTTTAGCGGATATACAAAGAGACTTTCCTGCAGCTTGAAATCTACTCTG
  
3' flanking region
GATACTGATATTGTGAACTTTGTAACACATTGTAGGTCAAGCCTCCTTGC
SNP nucleotide
TC
SNPdb format
ACTTTAGCGGATATACAAAGAGACTTTCCTGCAGCTTGAAATCTACTCTG[T/C]
GATACTGATATTGTGAACTTTGTAACACATTGTAGGTCAAGCCTCCTTGC
  
Genomic location of solcap_snp_sl_100728  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18269 marker 18269
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)