SGN Marker solcap_snp_sl_100732

SGN-M18273

Synonyms  
SGN-U314429_snp100
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66888)
Chromosome
3
Position
39.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63372)
Chromosome
3
Position
41.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54604)
Chromosome
3
Position
8.61 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTATTGCTTTGCTAGTGTTTTTGTTATATACAGGGGGTGGAGTTAGAG
  
3' flanking region
GTAAGTTACGCATTTAGTCGTAACTTTAGTCAAACTTCGTAATAATTTAG
SNP nucleotide
TG
SNPdb format
TTCTATTGCTTTGCTAGTGTTTTTGTTATATACAGGGGGTGGAGTTAGAG[T/G]
GTAAGTTACGCATTTAGTCGTAACTTTAGTCAAACTTCGTAATAATTTAG
  
Genomic location of solcap_snp_sl_100732  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18273 marker 18273
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)