SGN Marker T1200

SGN-M1828
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA67TV
Arabidopsis best BAC match: AC007660.2
Arabidopsis position: 2.2210000
Arabidopsis identities: 0.815
Best GenBank protein hit: AAD32803.1
Evalue: 2.3e-54
Identities: 0.761
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39541)
Chromosome
3
Position
74.90 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1200 was used as an overgo probe on plate 8 [well G7]

Plausible BAC Matches:   P153P19

 Overgo Sequences

A sequence
ATCTCTCGAACTGGCTTTGTCGAG
B sequence
AAGGAAAGGGCAAGAGCTCGACAA
AB sequence
ATCTCTCGAACTGGCTTTGTCGAGCTCTTG
Marker sequence
GAAAAATCCAAACCAATCCGGTCATGTATACCCCTACTAGTGACCTTTAT
TTATTTTCAAAACAGTAACTGCCATTCATAGAAATGTTACTTTTAAACTT
TAGTTCCTACATAAGACGGAAAATCGAAAAATGGTACAAAACAAGTCCAA
TTCTTAGGCCGCGAGCATGACTATAACTATAACGATTCAGACATCTGAGT
AGCAGAATTCACGTTGGTATCCACCGTCTTTGCTGGTCTGCGGCCCTTGT
CTGGGCCACCAATGATACCCCATCTCTCGAACTGGCTTTGTCGAGCTCTT
GCCCTTTCCTTTTCTTCCTCAGATTTTGATGCAAAGCAGTAGGGACAAGA
GACGGCATACTCCCATTCTGGGGATTCCATATCAGCATCGCTCACTGGTT
TCTTGCATCCATAGCAAAGTTTGAATGTTCCCTGTACCAAACCATGCTCA
ACAGAAACTCGTTTGTCAAATACAAAGCATTCCCCCTCCCAAAGGCTCTC
TGTCTTGGGAACTTCCTCCAGGTACCTTAAAATCCCACCTTCTAGATGAT
AAACCTCATCAAAACCTTTGGCGAGGAGAAAACTNGAAGCTTTCTCGCAT
CGAATTCCACCTGTACAGTACATT
Genomic location of T1200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1828 marker 1828
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)