SGN Marker solcap_snp_sl_100743

SGN-M18284

Synonyms  
SGN-U317657_C2_At3g47930_snp417
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63377)
Chromosome
10
Position
82.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54615)
Chromosome
10
Position
60.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCATAAGAGAACAACAGATTGGTGGCATTGTTCAGGTGATTGATTGATTT
  
3' flanking region
TTCCTGGATGTTTTAAACAACTTATCATGTCGATTTCTTGTGGATTACTC
SNP nucleotide
AG
SNPdb format
CCATAAGAGAACAACAGATTGGTGGCATTGTTCAGGTGATTGATTGATTT[A/G]
TTCCTGGATGTTTTAAACAACTTATCATGTCGATTTCTTGTGGATTACTC
  
Genomic location of solcap_snp_sl_100743  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18284 marker 18284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)