SGN Marker solcap_snp_sl_100745

SGN-M18286

Synonyms  
SGN-U318488_C2_At1g78230_snp247
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70362)
Chromosome
4
Position
61.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54617)
Chromosome
4
Position
57.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCNATTAACATAATTTATGTTTCCTTGGACANTGCAGTTCAAATAACTC
  
3' flanking region
GGGATCACTACCAAAGGGTCTTCATGTTCTCAATTTATCAAGGAACAAGA
SNP nucleotide
TC
SNPdb format
CCCNATTAACATAATTTATGTTTCCTTGGACANTGCAGTTCAAATAACTC[T/C]
GGGATCACTACCAAAGGGTCTTCATGTTCTCAATTTATCAAGGAACAAGA
  
Genomic location of solcap_snp_sl_100745  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18286 marker 18286
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)