SGN Marker solcap_snp_sl_100746

SGN-M18287

Synonyms  
SGN-U318588_C2_At4g22260_snp230
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66896)
Chromosome
11
Position
36.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54618)
Chromosome
11
Position
4.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAATGATTAGCATTCAATGATTAAAATAAAGGCAACCCGATGCACTAAG
  
3' flanking region
TTCCACTAGTTTTACGCCATTTTACAGTAGCACAACTCAAACTNGTGACC
SNP nucleotide
TC
SNPdb format
CAAATGATTAGCATTCAATGATTAAAATAAAGGCAACCCGATGCACTAAG[T/C]
TTCCACTAGTTTTACGCCATTTTACAGTAGCACAACTCAAACTNGTGACC
  
Genomic location of solcap_snp_sl_100746  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18287 marker 18287
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)