SGN Marker T1201

SGN-M1829
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.11
Tomato EST read: TPTAA69TH
Arabidopsis best BAC match: AB025626.1
Arabidopsis position: 3.0900000
Arabidopsis identities: 0.817
Best GenBank protein hit: CAA62476.1
Evalue: 1.8e-92
Identities: 0.984
Description: stpk1 protein kinase [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39542)
Chromosome
2
Position
140.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35599
Forward primer (5'-3')
CATGCACTTAGGCAAAAGCA
Digested band sizes (using MspI)
Solanum pennellii LA716: 500+600
Solanum lycopersicum LA925: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCAAATGTCCACCAATCT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 37
Forward primer (5'-3')
Unknown
Digested band sizes (using MspI)
Solanum pennellii LA716: 500+600
Solanum lycopersicum LA925: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1201 was used as an overgo probe on plate 11 [well E1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTGGAGATTTGCATGCACTTAGG
B sequence
TTCCTGGCTGCTTTTGCCTAAGTG
AB sequence
GGTGGAGATTTGCATGCACTTAGGCAAAAG
Marker sequence
GTTGGTGGAGATTTGCATGCACTTAGGCAAAAGCAGCCAGGAAAATTCTT
CCCGGAGCATGCTGCCAGGTTTTACGTGGCTGAAGTCCTTCTTGCTCTAG
AGTACTTGCACATGCTTGGAATCATTTACAGAGACCTTAAACCAGAGAAT
GTTTTGGTTCGAGAAGATGGCCATATAATGCTTTCTGATTTTGACCTCTC
CTTGAGGTGTGCCGTGAGCCCAACTCTAGTTAGATCTTCAAATTCAAGCT
TAGAGTGCAAGAGCTCATCATATTGTGTCCAGCCTGCTTGTATTGAGCCA
TCTTGTGTCGTACAGCCTGCATGTATCCAACCTTCATGTTTTACACCGCG
TTTTCTAAGCAAGAACAAGAAAGAAAAGAAGTCCAAACAAAAGACTGAAA
CATATAACCAAGTGAACCGGCCTCTTCCGGAACTCCTTGCTGAACCAACG
AGTGCTCGATCAATGTCTTTTGTGGGAACACATGAGTACCTAGCTCCAGA
AATTATAAAGGGTGAAGGACACGGCAGTGCTGTAGATTGGTGGACATTTG
GGATCTTTCTCTATGAACTCTTGTTTG
Genomic location of T1201  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1829 marker 1829
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)