SGN Marker solcap_snp_sl_100752

SGN-M18293

Synonyms  
SGN-U329720_C2_At2g01770_snp317
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70367)
Chromosome
4
Position
12.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54624)
Chromosome
4
Position
1.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACAANAGTGTTATGCTTTGTCGACTTCTTGTTTGTTGTTTTTTCATTATT
  
3' flanking region
TTTACAGTCCATTGAAAAGAAGAATCCCCTGTTCATACATTAAGAGTGGC
SNP nucleotide
AG
SNPdb format
ACAANAGTGTTATGCTTTGTCGACTTCTTGTTTGTTGTTTTTTCATTATT[A/G]
TTTACAGTCCATTGAAAAGAAGAATCCCCTGTTCATACATTAAGAGTGGC
  
Genomic location of solcap_snp_sl_100752  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18293 marker 18293
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)