SGN Marker solcap_snp_sl_100757

SGN-M18298

Synonyms  
SGN-U563666_snp169
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70374)
Chromosome
4
Position
34.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66905)
Chromosome
4
Position
47.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63387)
Chromosome
4
Position
47.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54629)
Chromosome
4
Position
5.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATAACAACACTACATGCAATGTAATGCAATGAAATTCCTGGTTCTGTCA
  
3' flanking region
TGAGTAACCGAAAAGGTTACATGATAGAGCAAGCATTAGGATTCTCGTCA
SNP nucleotide
TC
SNPdb format
AATAACAACACTACATGCAATGTAATGCAATGAAATTCCTGGTTCTGTCA[T/C]
TGAGTAACCGAAAAGGTTACATGATAGAGCAAGCATTAGGATTCTCGTCA
  
Genomic location of solcap_snp_sl_100757  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18298 marker 18298
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)