SGN Marker TG114

SGN-M183

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pUC
Cutting Site
HindIII/EcoR1
Drug Resistance
AMP
Image
Forward sequence
AAAGCAGTAAAGCAAGGTCCATTAATGGTATTACTATATCTTCAGCAGAAGGGCGATAACCAATCGGAAAATACTAAGAATTATGTAATT
GAGTTTCAAGATTTTATCTGTACTGAATTATGTATAGCATGATAAAAAGGTTCCAACACTTCTTTCTCCTTTTTAGGTCAGATAGCTCCA
TCACTTGATTCGACTTTTTCTTTTTTGTTTCTTACATCTCTTGATGTAAATAGAGAAGTGTTGATGATATGACATGTGTTGAGCTTAAAT
AACGAAATGAAGATTCATATAGCTGACCGCGACTTGTTTAGTATTTAGGCGTAGTTGTTGTTTTACTGTTATATCTGGTAAAGTTAAAAG
GGTGGTAAACTCTACAACTCTATGGTCTGCCTGATCTTGGTTTCTTGCTTAACTACGCACCTTCCCAAGTCTTATATTTCACCTAAACAA
AGCTAAAACTTTTCCCCTCATCAAAGTTTCCAAGCAAATATGATGGTGTGTACACTGCAATCAACCT
Reverse sequence
TCCTTTGTCTGTAAGTACAGCAGATGTCTTATTAGACTGAATAGAGATATTTGTTGACCAAATGATATTTTGATTGCCATCCATAATTAT
GAGGTTCCCATCACCTCCAATCTTCAAGATTGTATCAGAATCAGATGCTTGGAGTGGATCTTCTCTATTTGCTACCCAAACAACCCTCCG
ACGAGAAATATTCTTGAACCAAATTCCTATATATAGACTCCTCGAGCTACGTGGACTGAAGAAGCCCAGCTCAAATATATTTCCAGCAGA
GACAAGTGTCTGATTTAGAGACAGTTGTTGGGATTGAGTTAAGGTATCACTTGCAGCAGAGAGTTGCGCTAAAAGCATCCTTCCGAGCAT
CAGAAACAAAAAAAAATCCCATCTTGGCCATACCATCTTCTTTCCTTTTCTGATCATTCCCAGACTGAGCTACTCTCTAGAAATTCATAT
AAAAGACTTTCCAAAAGCATCCC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53509)
Chromosome
3
Position
4.94 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40829)
Chromosome
3
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36570
Forward primer (5'-3')
AAAGCAGTAAAGCAAGGTCCAT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTGACCAAATGATATTTTGATTGC
Digested band sizes (using DdeI)
Solanum lycopersicum TA209
600
Solanum pennellii TA56
1300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8476)
Chromosome
3
Position
14.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8477)
Chromosome
3
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG114 was used as an overgo probe on plate 2 [well C6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGGTCTGCCTGATCTTGGTTTCT
B sequence
GGTGCGTAGTTAAGCAAGAAACCA
AB sequence
ATGGTCTGCCTGATCTTGGTTTCTTGCTTA
Marker sequence
AAAGCAGTAAAGCAAGGTCCATTAATGGTATTACTATATCTTCAGCAGAA
GGGCGATAACCAATCGGAAAATACTAAGAATTATGTAATTGAGTTTCAAG
ATTTTATCTGTACTGAATTATGTATAGCATGATAAAAAGGTTCCAACACT
TCTTTCTCCTTTTTAGGTCAGATAGCTCCATCACTTGATTCGACTTTTTC
TTTTTTGTTTCTTACATCTCTTGATGTAAATAGAGAAGTGTTGATGATAT
GACATGTGTTGAGCTTAAATAACGAAATGAAGATTCATATAGCTGACCGC
GACTTGTTTAGTATTTAGGCGTAGTTGTTGTTTTACTGTTATATCTGGTA
AAGTTAAAAGGGTGGTAAACTCTACAACTCTATGGTCTGCCTGATCTTGG
TTTCTTGCTTAACTACGCACCTTCCCAAGTCTTATATTTCACCTAAACAA
AGCTAAAACTTTTCCCCTCATCAAAGTTTCCAAGCAAATATGATGGTGTG
TACACTGCAATCAACCT
Genomic location of TG114  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D183 marker 183
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)