SGN Marker solcap_snp_sl_100761

SGN-M18302

Synonyms  
SGN-U564051_snp225
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66908)
Chromosome
7
Position
46.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63390)
Chromosome
7
Position
60.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54633)
Chromosome
7
Position
61.40 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCTCTTTTCCAGCTCTGTTCCTTCAAAACAGAGTTTTTAAGCATTAGC
  
3' flanking region
ATATAGGATTGAGTAGTAGCAACATGATACAGAAGGTGATTCTTCATGTC
SNP nucleotide
AC
SNPdb format
TCTCTCTTTTCCAGCTCTGTTCCTTCAAAACAGAGTTTTTAAGCATTAGC[A/C]
ATATAGGATTGAGTAGTAGCAACATGATACAGAAGGTGATTCTTCATGTC
  
Genomic location of solcap_snp_sl_100761  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18302 marker 18302
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)