SGN Marker solcap_snp_sl_100764

SGN-M18305

Synonyms  
SGN-U564980_snp30740
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70380)
Chromosome
11
Position
61.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66912)
Chromosome
11
Position
61.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63394)
Chromosome
11
Position
73.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54636)
Chromosome
11
Position
49.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCTAGAGATTCTCTTTTTGATATATTCTCAGCTCATATATAAGCTTTTA
  
3' flanking region
GGACGCAATATCTTCGCTGTCTGAATGTCTTGGCAACGTGTGGTGGGAGA
SNP nucleotide
TC
SNPdb format
AGCTAGAGATTCTCTTTTTGATATATTCTCAGCTCATATATAAGCTTTTA[T/C]
GGACGCAATATCTTCGCTGTCTGAATGTCTTGGCAACGTGTGGTGGGAGA
  
Genomic location of solcap_snp_sl_100764  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18305 marker 18305
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)