SGN Marker T1203

SGN-M1831
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAA74TV
Arabidopsis best BAC match: U93215.2
Arabidopsis position: 2.1730000
Arabidopsis identities: 0.770
Best GenBank protein hit: AAB63077.1
Evalue: 2.0e-28
Identities: 0.553
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49405)
Chromosome
4
Position
63.67 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47339)
Chromosome
4
Position
126.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39544)
Chromosome
4
Position
135.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1203 was used as an overgo probe on plate 6 [well H1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTGGCACATCATATGGGAAACAC
B sequence
CAGGATTTACCCACTGGTGTTTCC
AB sequence
GCTGGCACATCATATGGGAAACACCAGTGG
Marker sequence
TTCTCCATGCACTTCGATTATTGTACAACTGCAAGCATTGACTTTGTCAT
GTTAGATGAATCAAGTTTTAGCAATATCCTTCAGCATACAGATTTGACTG
TGACATCTGAAGAGAGAGTTCTCAATGCCATCTTGCTTTGGTGCTTACAA
GCAAGAGAACTGTATGGATGGGAAGCAGTAAACGAATTGATGGTAAATTC
AACACCTGAGATGCTTTTTGGAGAGAGACTTGAGTCTCTAAATGAATTTC
TGCAACTTGTGCGGTTCCCTTTACTTTCACCTGATTTGCTGAATAAGTTT
GAACAGAGTAGCCTTAGCCAGCAAATTCCCACTTTTGACCATCTGGTTAA
AGAGGCATTAAGATTTCTGGAATTTGAGATCACCGATTTTCAAGGAAACC
AGAGATTTCAGCATAGAAAATCAAGTTTTAAGGAGCTGCTCTACATATGC
GATGGAGATAGCAACGGGGTCCTTTATTTTGCTGGCACATCATATGGGAA
ACACCAGTGGGTAAATCCTGTTTTGTCCAAGAGAGTAATTATCACGGCTA
GTAGCCCCATTTCAAGATGCACTGATCCCAAGGTGTTGGTATCAAAGAAC
TT
Genomic location of T1203  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1831 marker 1831
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)