SGN Marker solcap_snp_sl_100785

SGN-M18326

Synonyms  
SGN-U569291_snp1086
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70398)
Chromosome
3
Position
9.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66930)
Chromosome
3
Position
22.58 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63412)
Chromosome
3
Position
27.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54657)
Chromosome
3
Position
1.70 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGTTCGTGGCCTTGTAAGCAATTTTCCCCCATACACAATCACCATTTA
  
3' flanking region
TTATAACCCTTTTTCAGTAGAAGACATTTTGTTATCTAAACGGCTGGGAA
SNP nucleotide
TC
SNPdb format
AATGTTCGTGGCCTTGTAAGCAATTTTCCCCCATACACAATCACCATTTA[T/C]
TTATAACCCTTTTTCAGTAGAAGACATTTTGTTATCTAAACGGCTGGGAA
  
Genomic location of solcap_snp_sl_100785  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18326 marker 18326
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)