SGN Marker solcap_snp_sl_100787

SGN-M18328

Synonyms  
SGN-U569555_snp276
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54659)
Chromosome
3
Position
60.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTTGTTCATCTTCTGCTGTTGCCGATCCGTATAAGACCTTGAAGATTC
  
3' flanking region
ACCCGGTGCATCTGAATCTGAAGTTAGGAAGGCGTTTAGACAGCTTGCTC
SNP nucleotide
AG
SNPdb format
TGTTTGTTCATCTTCTGCTGTTGCCGATCCGTATAAGACCTTGAAGATTC[A/G]
ACCCGGTGCATCTGAATCTGAAGTTAGGAAGGCGTTTAGACAGCTTGCTC
  
Genomic location of solcap_snp_sl_100787  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18328 marker 18328
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)