SGN Marker solcap_snp_sl_100788

SGN-M18329

Synonyms  
SGN-U570129_snp163
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70399)
Chromosome
12
Position
29.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66931)
Chromosome
12
Position
40.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63413)
Chromosome
12
Position
44.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54660)
Chromosome
12
Position
3.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAATATCACAAGTTATCTTTCTTTGATCAAGTTGCTGATGTAGCACACTT
  
3' flanking region
CCTCTTGTTCTTTTCTATCCTCATTGTAAGAACAACTCGAAACATGAAGA
SNP nucleotide
AG
SNPdb format
AAATATCACAAGTTATCTTTCTTTGATCAAGTTGCTGATGTAGCACACTT[A/G]
CCTCTTGTTCTTTTCTATCCTCATTGTAAGAACAACTCGAAACATGAAGA
  
Genomic location of solcap_snp_sl_100788  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18329 marker 18329
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)