SGN Marker solcap_snp_sl_100793

SGN-M18334

Synonyms  
SGN-U570986_snp1562
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70402)
Chromosome
10
Position
55.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54665)
Chromosome
10
Position
61.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAATAAAGCAATCTGGAGATCATACAGCTTTCTAGTCATTTTGCTCCGT
  
3' flanking region
AATCATTGGTCAACAATATTTTCACCAGACTACCAACAGCATATATCAGA
SNP nucleotide
AC
SNPdb format
AAAATAAAGCAATCTGGAGATCATACAGCTTTCTAGTCATTTTGCTCCGT[A/C]
AATCATTGGTCAACAATATTTTCACCAGACTACCAACAGCATATATCAGA
  
Genomic location of solcap_snp_sl_100793  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18334 marker 18334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)