SGN Marker solcap_snp_sl_100804

SGN-M18345

Synonyms  
SGN-U573565_snp665
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70408)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66938)
Chromosome
12
Position
0.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63420)
Chromosome
12
Position
1.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54676)
Chromosome
12
Position
0.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCTTCAATATTGACTGTAATGAAGGAGATTTCTGATACATTGTACCCAA
  
3' flanking region
GCCTGTCGTGATTTTTAATCCTAAATGGGGTTTTGATGAAGAGAGTAGTT
SNP nucleotide
AT
SNPdb format
GGCTTCAATATTGACTGTAATGAAGGAGATTTCTGATACATTGTACCCAA[A/T]
GCCTGTCGTGATTTTTAATCCTAAATGGGGTTTTGATGAAGAGAGTAGTT
  
Genomic location of solcap_snp_sl_100804  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18345 marker 18345
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)