SGN Marker solcap_snp_sl_100805

SGN-M18346

Synonyms  
SGN-U573625_snp168
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54677)
Chromosome
4
Position
49.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGTATGTGAGAGAGAAAGTATCGGAGTAATTTAAGGGTTAAATGAATG
  
3' flanking region
GAACCGACCCGCCTTCCCTTCTTTCTCTCGCTATTGACTCTGCCCTTCTT
SNP nucleotide
AG
SNPdb format
AGAGTATGTGAGAGAGAAAGTATCGGAGTAATTTAAGGGTTAAATGAATG[A/G]
GAACCGACCCGCCTTCCCTTCTTTCTCTCGCTATTGACTCTGCCCTTCTT
  
Genomic location of solcap_snp_sl_100805  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18346 marker 18346
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)