SGN Marker T1208

SGN-M1835
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAA82TH
Arabidopsis best BAC match: AC005278.1
Arabidopsis position: 1.0050000
Arabidopsis identities: 0.376
Best GenBank protein hit: BAA03413.1
Evalue: 9.1e-31
Identities: 0.422
Description: EDGP precursor [Daucus carota]
Comment: extracellular dermal glycoprotein of carrot
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49406)
Chromosome
1
Position
71.66 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47340)
Chromosome
1
Position
49.09 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39546)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1208 was used as an overgo probe on plate 10 [well A4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTATGGGCTGATTGTGGGTTGACT
B sequence
GACTTGAGGAATCAGAAGTCAACC
AB sequence
CTATGGGCTGATTGTGGGTTGACTTCTGAT
Marker sequence
CTTGGTTTCATTCTGTGTTTCTCATGGACCCTTTTTACCAAAAGCCATTA
TTCTCCCTGTAAACAAAGATCCATCTACTTTTCAATATGTTACTCAACTC
TACATGGGTGTTACTCATCTTGCTCCCATCAAATTAGTTGTAGATCTTGA
AGGTTCATTTCTATGGGCTGATTGTGGGTTGACTTCTGATTCCTCAAGTC
AAAAACTTGTACCTTGTAATTCACTCAAATGTTCCATGGCTAAGCCTAAT
GGTTGTACTAATGACAACAAGATCTGTGGTTTGAAATCAGAAAACCCCTT
TACAAGATTAGCTGCAACAGGGGAATTAGCAGAGGATATGTTTGCTGTGG
AGTTTATTGATGAGTTGAAAACAGGCTCAGTTGCTTCAATTCATCAATTC
TTGTTTTCTTGTACATCATCTACTCTGTTACAAGGACTTGCTAGAGGTGC
TAAAAGTATGTTGGGGCTTGGTAATTCAAGAATTGCATTGCCATCTCAGT
TGTCTGATACATTTGGGTTTCAAA
Genomic location of T1208  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1835 marker 1835
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)