Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_100812

SGN-M18353

Synonyms  
SGN-U574978_snp62653
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70419)
Chromosome
4
Position
90.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54684)
Chromosome
4
Position
63.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGTTTAGGCCTTTAGGATCCAAATTAAGTCCCGTTCACTGACAGTCTC
  
3' flanking region
GCCGTGTCTACTCTGTCGCCGGTTGCCGCCGGTTGTCGCTGCTCGCACGT
SNP nucleotide
AT
SNPdb format
ATTGTTTAGGCCTTTAGGATCCAAATTAAGTCCCGTTCACTGACAGTCTC[A/T]
GCCGTGTCTACTCTGTCGCCGGTTGCCGCCGGTTGTCGCTGCTCGCACGT
  
Genomic location of solcap_snp_sl_100812  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18353 marker 18353
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)