Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_100813

SGN-M18354

Synonyms  
SGN-U575271_snp147
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54685)
Chromosome
4
Position
2.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCGAGATGATGGAAATTGAAATTGCGTCCCTTTACCACTACGTATAAG
  
3' flanking region
TGGTCAAGCTGATTTTGAGTTGTTTTCGGTACAACTTTTAGCTTGAATAT
SNP nucleotide
TC
SNPdb format
TCTCGAGATGATGGAAATTGAAATTGCGTCCCTTTACCACTACGTATAAG[T/C]
TGGTCAAGCTGATTTTGAGTTGTTTTCGGTACAACTTTTAGCTTGAATAT
  
Genomic location of solcap_snp_sl_100813  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18354 marker 18354
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)