SGN Marker solcap_snp_sl_100824

SGN-M18365

Synonyms  
SGN-U575806_snp19552
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66952)
Chromosome
12
Position
2.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63430)
Chromosome
12
Position
2.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54696)
Chromosome
12
Position
0.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGACGACCGTTGTCTCGATCTTCTTCATTAACAGAAGACAGACTCAGGCT
  
3' flanking region
TATACAGCTTTGCTCACTTCACCAAAGCCTAATCAGGACGATTTTGATTT
SNP nucleotide
AT
SNPdb format
AGACGACCGTTGTCTCGATCTTCTTCATTAACAGAAGACAGACTCAGGCT[A/T]
TATACAGCTTTGCTCACTTCACCAAAGCCTAATCAGGACGATTTTGATTT
  
Genomic location of solcap_snp_sl_100824  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18365 marker 18365
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)