SGN Marker solcap_snp_sl_100836

SGN-M18377

Synonyms  
SGN-U576696_snp63171
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54708)
Chromosome
2
Position
41.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTGTTTTATGTGAAACCAGGCTGGTCGCCAAGTCAACACAACTGGAGA
  
3' flanking region
TGAGAAGACGCAGAAAGAGGCTGAAGTAGAAAAACTGATGGAAGAAAATG
SNP nucleotide
AG
SNPdb format
GTTTGTTTTATGTGAAACCAGGCTGGTCGCCAAGTCAACACAACTGGAGA[A/G]
TGAGAAGACGCAGAAAGAGGCTGAAGTAGAAAAACTGATGGAAGAAAATG
  
Genomic location of solcap_snp_sl_100836  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18377 marker 18377
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)