SGN Marker solcap_snp_sl_100844

SGN-M18385

Synonyms  
SGN-U577015_snp274
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54716)
Chromosome
4
Position
1.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGTCATCAAATGATCAAAACTTCTCTAATCATCATCAACATGAACTCAA
  
3' flanking region
ATCATGTCTAATTTTCATAATGATCATCATATGAATAATATTAGCCATGA
SNP nucleotide
TC
SNPdb format
TTGTCATCAAATGATCAAAACTTCTCTAATCATCATCAACATGAACTCAA[T/C]
ATCATGTCTAATTTTCATAATGATCATCATATGAATAATATTAGCCATGA
  
Genomic location of solcap_snp_sl_100844  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18385 marker 18385
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)