SGN Marker solcap_snp_sl_100864

SGN-M18405

Synonyms  
SGN-U578537_snp44516
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54736)
Chromosome
11
Position
50.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAGGGCCAACTCTATCTCTTGAGTGCCCTCATCCTAATCAAGTCATCTC
  
3' flanking region
TCAATCAAATTTGCAAGCTTTGGCACTCCTCAAGGAACATGCGGGAGCTT
SNP nucleotide
AT
SNPdb format
TCAGGGCCAACTCTATCTCTTGAGTGCCCTCATCCTAATCAAGTCATCTC[A/T]
TCAATCAAATTTGCAAGCTTTGGCACTCCTCAAGGAACATGCGGGAGCTT
  
Genomic location of solcap_snp_sl_100864  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18405 marker 18405
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)