SGN Marker solcap_snp_sl_100866

SGN-M18407

Synonyms  
SGN-U578537_snp45069
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66973)
Chromosome
11
Position
78.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63449)
Chromosome
11
Position
93.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54738)
Chromosome
11
Position
50.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGTCGCAAAAAGTTTAGCTGTAGAAGCTTCTTGTACATGATGCCTCACG
  
3' flanking region
AACTAATGAACCGAGAAGGCACGTTCCTTAAGTGTTAAAGTAGTATAAGG
SNP nucleotide
AG
SNPdb format
GAGTCGCAAAAAGTTTAGCTGTAGAAGCTTCTTGTACATGATGCCTCACG[A/G]
AACTAATGAACCGAGAAGGCACGTTCCTTAAGTGTTAAAGTAGTATAAGG
  
Genomic location of solcap_snp_sl_100866  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18407 marker 18407
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)