SGN Marker solcap_snp_sl_100880

SGN-M18421

Synonyms  
SGN-U579212_snp25451
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66980)
Chromosome
3
Position
80.69 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63456)
Chromosome
3
Position
84.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54752)
Chromosome
3
Position
60.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCTTCTAATTAAAGGTTTGTGATTGCAGGTCTGTCGTAAATGGTGCACT
  
3' flanking region
AAATGGTTAAGAGACAACCTGTAGTACTTGGTGCTGGGATACTGCCTCAG
SNP nucleotide
AG
SNPdb format
TCCTTCTAATTAAAGGTTTGTGATTGCAGGTCTGTCGTAAATGGTGCACT[A/G]
AAATGGTTAAGAGACAACCTGTAGTACTTGGTGCTGGGATACTGCCTCAG
  
Genomic location of solcap_snp_sl_100880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18421 marker 18421
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)