SGN Marker solcap_snp_sl_100891

SGN-M18432

Synonyms  
CL017365-0306
SGN-U580402_snp388
SGN-U580402_snp388_CL017365-0306
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54763)
Chromosome
12
Position
0.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTATATTAAGCTTCTTCTACTATGGTACAAATACAAGTATCCCAATTGG
  
3' flanking region
AATAGCACAATAAATGGATTTTACCAAGGCCATGACAAGAAAGCAAAGAA
SNP nucleotide
AT
SNPdb format
ATTATATTAAGCTTCTTCTACTATGGTACAAATACAAGTATCCCAATTGG[A/T]
AATAGCACAATAAATGGATTTTACCAAGGCCATGACAAGAAAGCAAAGAA
  
Genomic location of solcap_snp_sl_100891  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18432 marker 18432
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)