SGN Marker solcap_snp_sl_100897

SGN-M18438

Synonyms  
SGN-U581496_snp423
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70465)
Chromosome
4
Position
9.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66995)
Chromosome
4
Position
18.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63471)
Chromosome
4
Position
14.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54769)
Chromosome
4
Position
1.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAATCCCTCTTGTTTCGAAATATCCGATTCATCGCGTAGTTGATCATGT
  
3' flanking region
TACGAACTCAACGAATCAAAAGATCGGTGCTAACTTGATCATGTTCATCG
SNP nucleotide
AG
SNPdb format
AAAATCCCTCTTGTTTCGAAATATCCGATTCATCGCGTAGTTGATCATGT[A/G]
TACGAACTCAACGAATCAAAAGATCGGTGCTAACTTGATCATGTTCATCG
  
Genomic location of solcap_snp_sl_100897  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18438 marker 18438
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)