SGN Marker solcap_snp_sl_100916

SGN-M18456

Synonyms  
SGN-U584349_snp118
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67002)
Chromosome
3
Position
78.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63477)
Chromosome
3
Position
84.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54787)
Chromosome
3
Position
59.88 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCCTTCTCATCTTCCAAATCTACACCTATCTTTCTGCTGCTGCAACTA
  
3' flanking region
TACTGCAAATCTCAGACTTACAACTCATAATTTTAGTAATTTTTTAGTTT
SNP nucleotide
AC
SNPdb format
TCTCCTTCTCATCTTCCAAATCTACACCTATCTTTCTGCTGCTGCAACTA[A/C]
TACTGCAAATCTCAGACTTACAACTCATAATTTTAGTAATTTTTTAGTTT
  
Genomic location of solcap_snp_sl_100916  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18456 marker 18456
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)